ribosomal ribonucleic acid

Ribosomal ribonucleic acid (rRNA) is the RNA component of the ribosome, and is essential for protein synthesis in all living organisms.

List of Abbreviations HGT horizontal gene transfer COG cluster of orthologous groups ML maximum likelihood rRNA ribosomal ribonucleic acid sp.

Only recently has it become possible to determine the identities and relative abundances of organisms in natural populations, typically using PCR-based strategies that target 16 S small subunit ribosomal ribonucleic acid (16S rRNA) genes.

As previously described, the northern blot results were normalised by rehybridising the filters with a P 3 2 -labelled oligonucleotide (5'AACGATCAGAGTAGTGGTATTTCACC 3') that corresponds with the 28s ribosomal ribonucleic acid.